Review




Structured Review

Santa Cruz Biotechnology tx
Tx, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 97/100, based on 21555 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/GAPDH+Antibody/pmc12386918-137-151-147
Average 97 stars, based on 21555 article reviews
tx - by Bioz Stars, 2026-09
97/100 stars

Images

Related Articles

Western Blot:

Article Title: Administration of the benzodiazepine midazolam increases tau phosphorylation in the mouse brain
Article Snippet: A detailed summary of all of the antibodies used in these studies is shown in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Antibody Phospho-Epitope Type Source Manufacturer Location Catalog # WB Dilution Tau Tau46 Total Tau Monoclonal Mouse Cell Signaling Danvers, MA 4019 1:2500 Anti-Human Tau A0024 Total Tau 243-441 Polyclonal Rabbit Dako Cytomation Carpinteria, CA A002401-2 1:10000 TG5 Total Tau 220-240 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT8 pSer202/pThr205 Monoclonal Mouse Thermo Scientific Waltham, MA MN1020 1:10000 CP13 pSer202 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 PHF-1 pSer396/pSer404 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT180 pThr231 Monoclonal Mouse Thermo Scientific Waltham, MA MN1040 1:1000 PS422 pSer422 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-764G 1:1000 PS262 pSer262 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-750G 1:1000 PS199 pSer199 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-734G 1:1000 AT270 pThr181 Monoclonal Mouse Thermo Scientific Waltham, MA MN1050 1:1000 12 E8 pSer262/pSer356 Monoclonal Mouse Pharmaceuticals Francisco, CA N/A 1:1000 Kinases GSK-3β Monoclonal Rabbit Cell Signaling Danvers, MA 9315 1:1000 Phospho-GSK-3 β (Ser9) Ser9 Polyclonal Rabbit Cell Signaling Danvers, MA 9336 1:1000 SAPK/JNK Monoclonal Rabbit Cell Signaling Danvers, MA 9258 1:1000 Phospho-SAPK/JNK Thr183/Tyr185 Monoclonal Rabbit Cell Signaling Danvers, MA 4671 1:1000 p44/42 MAPK Monoclonal Mouse Cell Signaling Danvers, MA 9107 1:2000 Phospho-p44/42 MAPK Thr202/Tyr204 Monoclonal Mouse Cell Signaling Danvers, MA 9106 1:2000 CaMKII Polyclonal Rabbit Cell Signaling Danvers, MA 3362 1:1000 Phospho-CaMKII Thr286 Polyclonal Rabbit Cell Signaling Danvers, MA 3361 1:1000 p35/25 Monoclonal Rabbit Cell Signaling Danvers, MA 2680 1:1000 Phosphatases PP2A-C (catalytic subunit) Monoclonal Mouse Sigma-Aldrich St. Louis, MO A5316 1:10000 demethylated PP2A-C Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 PP1 (E-9) Monoclonal Mouse Santa Cruz Dallas, TX sc-7482 1:1000 Pan-Calcineurin A (PP2B) Polyclonal Rabbit Cell Signaling Danvers, MA 2614 1:1000 PP5 Polyclonal Rabbit Cell Signaling Danvers, MA 2289 1:1000 Gel loading Controls β-actin Monoclonal Mouse Sigma-Aldrich St.Louis, MO A5316 1:10000 β3-tubulin Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 Open in a separate window List of antibodies used .. A detailed summary of all of the antibodies used in these studies is shown in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Antibody Phospho-Epitope Type Source Manufacturer Location Catalog # WB Dilution Tau Tau46 Total Tau Monoclonal Mouse Cell Signaling Danvers, MA 4019 1:2500 Anti-Human Tau A0024 Total Tau 243-441 Polyclonal Rabbit Dako Cytomation Carpinteria, CA A002401-2 1:10000 TG5 Total Tau 220-240 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT8 pSer202/pThr205 Monoclonal Mouse Thermo Scientific Waltham, MA MN1020 1:10000 CP13 pSer202 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 PHF-1 pSer396/pSer404 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT180 pThr231 Monoclonal Mouse Thermo Scientific Waltham, MA MN1040 1:1000 PS422 pSer422 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-764G 1:1000 PS262 pSer262 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-750G 1:1000 PS199 pSer199 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-734G 1:1000 AT270 pThr181 Monoclonal Mouse Thermo Scientific Waltham, MA MN1050 1:1000 12 E8 pSer262/pSer356 Monoclonal Mouse Pharmaceuticals Francisco, CA N/A 1:1000 Kinases GSK-3β Monoclonal Rabbit Cell Signaling Danvers, MA 9315 1:1000 Phospho-GSK-3 β (Ser9) Ser9 Polyclonal Rabbit Cell Signaling Danvers, MA 9336 1:1000 SAPK/JNK Monoclonal Rabbit Cell Signaling Danvers, MA 9258 1:1000 Phospho-SAPK/JNK Thr183/Tyr185 Monoclonal Rabbit Cell Signaling Danvers, MA 4671 1:1000 p44/42 MAPK Monoclonal Mouse Cell Signaling Danvers, MA 9107 1:2000 Phospho-p44/42 MAPK Thr202/Tyr204 Monoclonal Mouse Cell Signaling Danvers, MA 9106 1:2000 CaMKII Polyclonal Rabbit Cell Signaling Danvers, MA 3362 1:1000 Phospho-CaMKII Thr286 Polyclonal Rabbit Cell Signaling Danvers, MA 3361 1:1000 p35/25 Monoclonal Rabbit Cell Signaling Danvers, MA 2680 1:1000 Phosphatases PP2A-C (catalytic subunit) Monoclonal Mouse Sigma-Aldrich St. Louis, MO A5316 1:10000 demethylated PP2A-C Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 PP1 (E-9) Monoclonal Mouse Santa Cruz Dallas, TX sc-7482 1:1000 Pan-Calcineurin A (PP2B) Polyclonal Rabbit Cell Signaling Danvers, MA 2614 1:1000 PP5 Polyclonal Rabbit Cell Signaling Danvers, MA 2289 1:1000 Gel loading Controls β-actin Monoclonal Mouse Sigma-Aldrich St.Louis, MO A5316 1:10000 β3-tubulin Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 Open in a separate window List of antibodies used ..

Article Title: Administration of the benzodiazepine midazolam increases tau phosphorylation in the mouse brain
Article Snippet: A detailed summary of all of the antibodies used in these studies is shown in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Antibody Phospho-Epitope Type Source Manufacturer Location Catalog # WB Dilution Tau Tau46 Total Tau Monoclonal Mouse Cell Signaling Danvers, MA 4019 1:2500 Anti-Human Tau A0024 Total Tau 243-441 Polyclonal Rabbit Dako Cytomation Carpinteria, CA A002401-2 1:10000 TG5 Total Tau 220-240 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT8 pSer202/pThr205 Monoclonal Mouse Thermo Scientific Waltham, MA MN1020 1:10000 CP13 pSer202 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 PHF-1 pSer396/pSer404 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT180 pThr231 Monoclonal Mouse Thermo Scientific Waltham, MA MN1040 1:1000 PS422 pSer422 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-764G 1:1000 PS262 pSer262 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-750G 1:1000 PS199 pSer199 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-734G 1:1000 AT270 pThr181 Monoclonal Mouse Thermo Scientific Waltham, MA MN1050 1:1000 12 E8 pSer262/pSer356 Monoclonal Mouse Pharmaceuticals Francisco, CA N/A 1:1000 Kinases GSK-3β Monoclonal Rabbit Cell Signaling Danvers, MA 9315 1:1000 Phospho-GSK-3 β (Ser9) Ser9 Polyclonal Rabbit Cell Signaling Danvers, MA 9336 1:1000 SAPK/JNK Monoclonal Rabbit Cell Signaling Danvers, MA 9258 1:1000 Phospho-SAPK/JNK Thr183/Tyr185 Monoclonal Rabbit Cell Signaling Danvers, MA 4671 1:1000 p44/42 MAPK Monoclonal Mouse Cell Signaling Danvers, MA 9107 1:2000 Phospho-p44/42 MAPK Thr202/Tyr204 Monoclonal Mouse Cell Signaling Danvers, MA 9106 1:2000 CaMKII Polyclonal Rabbit Cell Signaling Danvers, MA 3362 1:1000 Phospho-CaMKII Thr286 Polyclonal Rabbit Cell Signaling Danvers, MA 3361 1:1000 p35/25 Monoclonal Rabbit Cell Signaling Danvers, MA 2680 1:1000 Phosphatases PP2A-C (catalytic subunit) Monoclonal Mouse Sigma-Aldrich St. Louis, MO A5316 1:10000 demethylated PP2A-C Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 PP1 (E-9) Monoclonal Mouse Santa Cruz Dallas, TX sc-7482 1:1000 Pan-Calcineurin A (PP2B) Polyclonal Rabbit Cell Signaling Danvers, MA 2614 1:1000 PP5 Polyclonal Rabbit Cell Signaling Danvers, MA 2289 1:1000 Gel loading Controls β-actin Monoclonal Mouse Sigma-Aldrich St.Louis, MO A5316 1:10000 β3-tubulin Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 Open in a separate window List of antibodies used 2.3. .. A detailed summary of all of the antibodies used in these studies is shown in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Antibody Phospho-Epitope Type Source Manufacturer Location Catalog # WB Dilution Tau Tau46 Total Tau Monoclonal Mouse Cell Signaling Danvers, MA 4019 1:2500 Anti-Human Tau A0024 Total Tau 243-441 Polyclonal Rabbit Dako Cytomation Carpinteria, CA A002401-2 1:10000 TG5 Total Tau 220-240 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT8 pSer202/pThr205 Monoclonal Mouse Thermo Scientific Waltham, MA MN1020 1:10000 CP13 pSer202 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 PHF-1 pSer396/pSer404 Monoclonal Mouse Peter Davies Bronx, NY N/A 1:1000 AT180 pThr231 Monoclonal Mouse Thermo Scientific Waltham, MA MN1040 1:1000 PS422 pSer422 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-764G 1:1000 PS262 pSer262 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-750G 1:1000 PS199 pSer199 Polyclonal Rabbit Life Technologies Carlsbad, CA 44-734G 1:1000 AT270 pThr181 Monoclonal Mouse Thermo Scientific Waltham, MA MN1050 1:1000 12 E8 pSer262/pSer356 Monoclonal Mouse Pharmaceuticals Francisco, CA N/A 1:1000 Kinases GSK-3β Monoclonal Rabbit Cell Signaling Danvers, MA 9315 1:1000 Phospho-GSK-3 β (Ser9) Ser9 Polyclonal Rabbit Cell Signaling Danvers, MA 9336 1:1000 SAPK/JNK Monoclonal Rabbit Cell Signaling Danvers, MA 9258 1:1000 Phospho-SAPK/JNK Thr183/Tyr185 Monoclonal Rabbit Cell Signaling Danvers, MA 4671 1:1000 p44/42 MAPK Monoclonal Mouse Cell Signaling Danvers, MA 9107 1:2000 Phospho-p44/42 MAPK Thr202/Tyr204 Monoclonal Mouse Cell Signaling Danvers, MA 9106 1:2000 CaMKII Polyclonal Rabbit Cell Signaling Danvers, MA 3362 1:1000 Phospho-CaMKII Thr286 Polyclonal Rabbit Cell Signaling Danvers, MA 3361 1:1000 p35/25 Monoclonal Rabbit Cell Signaling Danvers, MA 2680 1:1000 Phosphatases PP2A-C (catalytic subunit) Monoclonal Mouse Sigma-Aldrich St. Louis, MO A5316 1:10000 demethylated PP2A-C Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 PP1 (E-9) Monoclonal Mouse Santa Cruz Dallas, TX sc-7482 1:1000 Pan-Calcineurin A (PP2B) Polyclonal Rabbit Cell Signaling Danvers, MA 2614 1:1000 PP5 Polyclonal Rabbit Cell Signaling Danvers, MA 2289 1:1000 Gel loading Controls β-actin Monoclonal Mouse Sigma-Aldrich St.Louis, MO A5316 1:10000 β3-tubulin Monoclonal Mouse Cell Signaling Danvers, MA 4466 1:1000 Open in a separate window List of antibodies used 2.3. .. Nontransgenic 8 to 10-week-old C57BL/6 male mice were purchased from a commercial vendor (Taconic, Germantown, NY).

Transduction:

Article Title: Lung fibrosis is induced in ADAR2 overexpressing mice via HuR-induced CTGF signaling
Article Snippet: .. TABLE 1 Primary antibodies Source Identifier Rabbit polyclonal anti-CTGF Abcam, Cambridge, MA ab6992 Rabbit polyclonal anti-ADARB1 Proteintech 22248–1–AP Rabbit polyclonal anti-TTP Abcam, Cambridge, MA ab83579 Rabbit polyclonal anti-HuR Santa Cruz, Dallas, TX Sc–5261 Rabbit β-Actin-HRP Signal transduction #4970 Open in a separate window List of Primary antibodies used in this study. ..

Reverse Transcription Polymerase Chain Reaction:

Article Title: ARRDC5 expression is conserved in mammalian testes and required for normal sperm morphogenesis
Article Snippet: .. Reagents and Resource Source Identifier Antibodies & Probes Alexa Fluor 488 donkey anti mouse IgG (1:200) Invitrogen, Carlsbad, CA A21202 Alexa Fluor 488 donkey anti rabbit IgG (1:200) Invitrogen, Carlsbad, CA A21206 Alexa Fluor 546 donkey anti mouse IgG (1:200) Invitrogen, Carlsbad, CA A10036 Alexa Fluor 546 donkey anti rabbit IgG (1:200) Invitrogen, Carlsbad, CA A10040 Rabbit anti Arrdc5 polyclonal (1:200) Thermo Fisher Scientific, Waltham, MA PA5-71704 Mouse anti Ddx4 polyclonal (1:150) Abcam, Cambridge, UK ab27591 Lectin - PNA Alexa Fluor 488 Invitrogen, Carlsbad, CA L21409 Normal Mouse IgG (1:200) Santa Cruz Biotechnology, Dallas, TX sc-2025 Normal Rabbit IgG (1:200) Santa Cruz Biotechnology, Dallas, TX sc2027 Rabbit anti GFP polyclonal (1:250) Abcam, Cambridge, UK ab290 Oligonucleotides #1 Arrdc5 sgRNA (∆306) PAM GGG F Integrated DNA Technology, Coralville, Iowa GGAATCTGGATGATACTCGG #2 Arrdc5 sgRNA (∆306) PAM GGG R Integrated DNA Technology, Coralville, Iowa AAAGGTAAGCATTCGGCCTG #3 mus-Arrdc5 gDNA 455bp (genotyping) F Integrated DNA Technology, Coralville, Iowa AACATTGGGTGGAGCGATGT #4 mus-Arrdc5 gDNA 455bp (genotyping) R Integrated DNA Technology, Coralville, Iowa CCCTCTGCCTATCTCTAACTCG #5 mus-Arrdc5 cDNA exon1 435bp (RT-PCR) F Integrated DNA Technology, Coralville, Iowa GCCAGAGGAATCTAAGTGAGAACT #6 mus-Arrdc5 cDNA exon1 435bp (RT-PCR) R Integrated DNA Technology, Coralville, Iowa ACAAAGACCAGGGGAGGTGA #9 bos-Arrdc5 cDNA 249bp (RTPCR) F Integrated DNA Technology, Coralville, Iowa TTAGTGCTGCCCAAGGATGC #10 bos-Arrdc5 cDNA 249bp (RT-PCR) R Integrated DNA Technology, Coralville, Iowa GCCTGCACTTAACCAATTATCCTC #11 sus-Arrdc5 cDNA 541bp (RT-PCR) F Integrated DNA Technology, Coralville, Iowa AAAACCCATCGCAGATTCCTCT Supplemental Table S1. ..

Immunohistochemistry:

Article Title: Platelet-Derived Growth Factor Subunit B Signaling Promotes Pericyte Migration in Response to Loud Sound in the Cochlear Stria Vascularis
Article Snippet: .. Related antibody information is listed in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antibodies Vendors Catalog number Dilution Source Specificity PDGFR β Abcam, Cambridge, MA ab32570 1:50(with 1 % BSA-PBS) Rabbit Mouse, rat, human PDGF-BB Abcam, Cambridge, MA ab181341 1:50 (with 1 % BSA-PBS) Rabbit Mouse, rat, human Desmin Abcam, Cambridge, MA ab32362 1:50 (with 1 % BSA-PBS) Rabbit Mouse, rat, human GAPDH Santa Cruz Biotechnology sc-20,357 1:200(with 1 % BSA-PBS) Goat Mouse, rat, human Peroxidase-labeled anti-rabbit antibody GE healthcare Bio-Sciences, Pittsburgh, PA NIF 824 1:5000(with 5 % skim milk) Donkey Goat Donkey anti-goat IgG-HRP Santa Cruz Biotechnology, Dallas, TX SC-2020 1:5000(with 5 % skim milk) Donkey Goat Alexa Fluor 488-conjugated goat anti-rabbit IgG Invitrogen, Eugene, OR A-11008 1:100(with 1 % BSA-PBS) Goat Rabbit Open in a separate window Antibodies applied in the study Immunohistochemistry and Confocal Microscopy Immunohistochemistry was previously reported by Zhang et al. ( 2012 ). ..

Confocal Microscopy:

Article Title: Platelet-Derived Growth Factor Subunit B Signaling Promotes Pericyte Migration in Response to Loud Sound in the Cochlear Stria Vascularis
Article Snippet: .. Related antibody information is listed in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antibodies Vendors Catalog number Dilution Source Specificity PDGFR β Abcam, Cambridge, MA ab32570 1:50(with 1 % BSA-PBS) Rabbit Mouse, rat, human PDGF-BB Abcam, Cambridge, MA ab181341 1:50 (with 1 % BSA-PBS) Rabbit Mouse, rat, human Desmin Abcam, Cambridge, MA ab32362 1:50 (with 1 % BSA-PBS) Rabbit Mouse, rat, human GAPDH Santa Cruz Biotechnology sc-20,357 1:200(with 1 % BSA-PBS) Goat Mouse, rat, human Peroxidase-labeled anti-rabbit antibody GE healthcare Bio-Sciences, Pittsburgh, PA NIF 824 1:5000(with 5 % skim milk) Donkey Goat Donkey anti-goat IgG-HRP Santa Cruz Biotechnology, Dallas, TX SC-2020 1:5000(with 5 % skim milk) Donkey Goat Alexa Fluor 488-conjugated goat anti-rabbit IgG Invitrogen, Eugene, OR A-11008 1:100(with 1 % BSA-PBS) Goat Rabbit Open in a separate window Antibodies applied in the study Immunohistochemistry and Confocal Microscopy Immunohistochemistry was previously reported by Zhang et al. ( 2012 ). ..



Similar Products

97
Santa Cruz Biotechnology tx
Tx, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/GAPDH+Antibody/pmc12386918-137-151-147
Average 97 stars, based on 1 article reviews
tx - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology triton x100 pbs tx
Triton X100 Pbs Tx, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/Triton+X-100/pmc12159915-89-28-41
Average 96 stars, based on 1 article reviews
triton x100 pbs tx - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology tx sc 8439 aia 31240 mouse rabbit
Tx Sc 8439 Aia 31240 Mouse Rabbit, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/ICAM-1+Antibody/pmc06166945__pone__0204911__s002-0-83-79
Average 96 stars, based on 1 article reviews
tx sc 8439 aia 31240 mouse rabbit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology tx sc
Tx Sc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/normal+mouse+IgG/pmc10110545__41467_2023_37735_MOESM1_ESM-49-94-100
Average 96 stars, based on 1 article reviews
tx sc - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology tx hne 11s il 1 beta antibody santa cruz biotech
Tx Hne 11s Il 1 Beta Antibody Santa Cruz Biotech, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/4-Hydroxynonenal/pmc10114105__rqad013_suppl_supplementary_material-3-107-112
Average 93 stars, based on 1 article reviews
tx hne 11s il 1 beta antibody santa cruz biotech - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology tx cat sc 65495 rrid ab 2100037
Tx Cat Sc 65495 Rrid Ab 2100037, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/Endomucin+Antibody/pmc12235656-60-20-17
Average 96 stars, based on 1 article reviews
tx cat sc 65495 rrid ab 2100037 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology tx cat sc 32251 rrid ab 262054
Tx Cat Sc 32251 Rrid Ab 262054, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tx+sc/%CE%B1-Actin+Antibody/pmc12235656-60-64-61
Average 96 stars, based on 1 article reviews
tx cat sc 32251 rrid ab 262054 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results